Page 1 of 2 12 Last
Results 1 to 15 of 21
  1. #1
    Senior Member polar's Avatar
    Join Date
    Aug 2003
    Posts
    8,898

    Padres / Religion

    Not seen this one before and not sure where to put it.... so gone for the one I normally look at...

    Does the Army recognise religions other than abrahamic god (jew/islam/christian ... ha ha same category), hindu, sikh or buddist?

    I've seen agnostic, spiritiualist and aetheist mentioned... anymore..

    Rape & pillage anyone?

  2. #2
    Senior Member DarkNinja's Avatar
    Join Date
    Oct 2006
    Posts
    1,788

    Re: Padres / Religion

    be quite hard to have a Padre for atheists really - also a very short service! next
    Every man has a right to utter what he thinks truth, and every other man has a right to knock him down for it. Martyrdom is the test.
    Samuel Johnson

  3. #3
    Senior Member
    Join Date
    Aug 2007
    Posts
    14,345

    Re: Padres / Religion

    In the Navy they have a devil woshipper.

    http://www.cnn.com/2004/WORLD/europe...hip/index.html

    We have Rasta's in the army (despite true Rasta's say they wouldn't join because their religion says they cant).

    I suspect theres a few closet Jedis as well.
    I've only ever been wrong once and thats when I thought I was wrong but I was mistaken.

    Jimmy Carr: 99% of women kiss with their eyes closed... which is why rapists are so hard to identify

    DCI Gene Hunt: Do you know what? I once hit a bloke for speaking French

  4. #4
    Member
    Join Date
    Mar 2008
    Posts
    47

    Re: Padres / Religion

    Quote Originally Posted by stacker1
    I suspect theres a few closet Jedis as well.
    Closet!? I'm out and out mate! Not illegal in Army anymore is it? :D

  5. #5
    Senior Member The_Green_Manalishi's Avatar
    Join Date
    Feb 2006
    Posts
    302

    Re: Padres / Religion

    Quote Originally Posted by stacker1
    I suspect theres a few closet Jedis as well.
    And Pastafarians. Don't forget them!

    Click here to find out about the Church of the Flying Spaghetti Monster
    acacatgaaggtcgtgaagagaatatggctaatgctcttatttctcacat ctag

  6. #6
    Senior Member saladin's Avatar
    Join Date
    Jun 2006
    Posts
    2,025

    Re: Padres / Religion

    Cue memory of visit to Coy on training by the Padre.....CSM then proceeds to tell the boys that he's not a real Minister, he's a TA Padre -

    " Nah, he did a 2 week course - I mean, how could he be a real Reverend, He'd have his own job to do on a Sunday.....No, he's a TA Padre, rest of the week he runs a Builders Merchants"....


    ....last heard of the Rev in question was still a Padre, had gone "Regular" years past - and had landed the post of Chaplain to Christ Church, Naples. ....so there are some good postings left !

  7. #7
    Senior Member polar's Avatar
    Join Date
    Aug 2003
    Posts
    8,898

    Re: Padres / Religion

    ^I guess that had to happen. TA not really the best option for a reverend, some I've come accross work as a normal vicar during the week but in an Army camp.

  8. #8
    Senior Member ta_wannabe_sig's Avatar
    Join Date
    Mar 2009
    Posts
    235

    Re: Padres / Religion

    i watched a history program on bbc 2 last november about muslim soldiers during WWI and they had the only british Imam currently in the armend forces (i guess he covers all of them) he was'nt in 95's
    All comments are only personel opinions and i bow before the wisdom of the regulars on Arrse

    I apologies to all for the drivel i've posted and the drivel i will no doubt post in the future

    Apologies for any mong spelling and grammar

  9. #9
    Member OpsSuper's Avatar
    Join Date
    Aug 2009
    Location
    Up North
    Posts
    95

    Re: Padres / Religion

    Quote Originally Posted by ta_wannabe_sig
    i watched a history program on bbc 2 last november about muslim soldiers during WWI and they had the only british Imam currently in the armend forces (i guess he covers all of them) he was'nt in 95's
    I'm sure there was an article on the BBC website about it. Can't find it now mind....Wasn't in uniform but had accepted role as Iman to the Army / Armed Forces. From memory he was quite a young looking chap.

    On a different note, the Reg I've joined has been trying to get a Padres organised. Willing candidate found, biggest problem has been getting him a medical organised I was told by the ROSO... Mind you, that doesn't set him apart in the modern TA does it?
    Change is inevitable, except from vending machines....

  10. #10
    Senior Member Blyth_spirit's Avatar
    Join Date
    Dec 2005
    Posts
    802

    Re: Padres / Religion

    I recall a particularly contrary soldier who changed his religion to 'Wiccan' because he had discovered that it was not on the army list of major recognised religions and would therefore initiate a firestorm of paperwork for the battery clerk - with whom he was having a spat!
    "Leave the Artillerymen alone, they are an obstinate lot..." - Napoleon

  11. #11
    Senior Member polar's Avatar
    Join Date
    Aug 2003
    Posts
    8,898

    Re: Padres / Religion

    He should have put down heathen. I believe it's ok for them to date outside of their marriage, as long as the other party is of a different religion.... otherwise that'd be adultery and against army code of conduct..

  12. #12
    Senior Member Ravers's Avatar
    Join Date
    Apr 2008
    Location
    Getting high on paint fumes in the Focsle Locker.
    Posts
    4,188

    Re: Padres / Religion

    Quote Originally Posted by polar
    ^I guess that had to happen. TA not really the best option for a reverend, some I've come accross work as a normal vicar during the week but in an Army camp.
    My unit has a TA bish. He is a normal vicar in the week with his own church and everything.
    One cannot begin to fathom the immensity of the fuck I do not give.


  13. #13
    Senior Member
    Join Date
    Jun 2005
    Posts
    5,888

    Re: Padres / Religion

    If you are going to have a Padre, have a bike mad airborne one!

    http://www.hogeuropegallery.com/hog-...etiton-winner/

  14. #14
    Senior Member Monster's Avatar
    Join Date
    Jul 2006
    Posts
    195

    Re: Padres / Religion

    Quote Originally Posted by The_Duke
    If you are going to have a Padre, have a bike mad airborne one!

    http://www.hogeuropegallery.com/hog-...etiton-winner/
    I did a week climbing with him, what a legend

  15. #15
    Senior Member Badgertastic's Avatar
    Join Date
    Apr 2009
    Posts
    272

    Re: Padres / Religion

    One lad in my last unit put himself down as a pagan on joining. Roman Catholicism apparently covers paganism as well, at least according to his ID discs...
    If you can't fix it with a hammer, it's an electrical problem.

Page 1 of 2 12 Last

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
From arrse2.arrse.co.uk