Thread: Padres / Religion
-
06-01-2010, 18:27 #1
Padres / Religion
Not seen this one before and not sure where to put it.... so gone for the one I normally look at...
Does the Army recognise religions other than abrahamic god (jew/islam/christian ... ha ha same category), hindu, sikh or buddist?
I've seen agnostic, spiritiualist and aetheist mentioned... anymore..
Rape & pillage anyone?
-
06-01-2010, 18:30 #2
Re: Padres / Religion
be quite hard to have a Padre for atheists really - also a very short service! next
Every man has a right to utter what he thinks truth, and every other man has a right to knock him down for it. Martyrdom is the test.
Samuel Johnson
-
06-01-2010, 18:32 #3Senior Member

- Join Date
- Aug 2007
- Posts
- 14,345
Re: Padres / Religion
In the Navy they have a devil woshipper.
http://www.cnn.com/2004/WORLD/europe...hip/index.html
We have Rasta's in the army (despite true Rasta's say they wouldn't join because their religion says they cant).
I suspect theres a few closet Jedis as well.I've only ever been wrong once and thats when I thought I was wrong but I was mistaken.
Jimmy Carr: 99% of women kiss with their eyes closed... which is why rapists are so hard to identify
DCI Gene Hunt: Do you know what? I once hit a bloke for speaking French
-
06-01-2010, 20:22 #4Member
- Join Date
- Mar 2008
- Posts
- 47
Re: Padres / Religion
Closet!? I'm out and out mate! Not illegal in Army anymore is it? :D
Originally Posted by stacker1
-
07-01-2010, 00:23 #5
Re: Padres / Religion
And Pastafarians. Don't forget them!
Originally Posted by stacker1
Click here to find out about the Church of the Flying Spaghetti Monsteracacatgaaggtcgtgaagagaatatggctaatgctcttatttctcacat ctag
-
07-01-2010, 00:32 #6
Re: Padres / Religion
Cue memory of visit to Coy on training by the Padre.....CSM then proceeds to tell the boys that he's not a real Minister, he's a TA Padre -
" Nah, he did a 2 week course - I mean, how could he be a real Reverend, He'd have his own job to do on a Sunday.....No, he's a TA Padre, rest of the week he runs a Builders Merchants"....
....last heard of the Rev in question was still a Padre, had gone "Regular" years past - and had landed the post of Chaplain to Christ Church, Naples. ....so there are some good postings left !
-
07-01-2010, 01:03 #7
Re: Padres / Religion
^I guess that had to happen. TA not really the best option for a reverend, some I've come accross work as a normal vicar during the week but in an Army camp.
-
07-01-2010, 12:41 #8
Re: Padres / Religion
i watched a history program on bbc 2 last november about muslim soldiers during WWI and they had the only british Imam currently in the armend forces (i guess he covers all of them) he was'nt in 95's
All comments are only personel opinions and i bow before the wisdom of the regulars on Arrse
I apologies to all for the drivel i've posted and the drivel i will no doubt post in the future
Apologies for any mong spelling and grammar
-
08-01-2010, 01:51 #9
Re: Padres / Religion
I'm sure there was an article on the BBC website about it. Can't find it now mind....Wasn't in uniform but had accepted role as Iman to the Army / Armed Forces. From memory he was quite a young looking chap.
Originally Posted by ta_wannabe_sig
On a different note, the Reg I've joined has been trying to get a Padres organised. Willing candidate found, biggest problem has been getting him a medical organised I was told by the ROSO... Mind you, that doesn't set him apart in the modern TA does it?Change is inevitable, except from vending machines....
-
08-01-2010, 12:47 #10
Re: Padres / Religion
I recall a particularly contrary soldier who changed his religion to 'Wiccan' because he had discovered that it was not on the army list of major recognised religions and would therefore initiate a firestorm of paperwork for the battery clerk - with whom he was having a spat!
"Leave the Artillerymen alone, they are an obstinate lot..." - Napoleon
-
08-01-2010, 15:12 #11
Re: Padres / Religion
He should have put down heathen. I believe it's ok for them to date outside of their marriage, as long as the other party is of a different religion.... otherwise that'd be adultery and against army code of conduct..
-
08-01-2010, 15:30 #12Senior Member
- Join Date
- Apr 2008
- Location
- Getting high on paint fumes in the Focsle Locker.
- Posts
- 4,188
Re: Padres / Religion
My unit has a TA bish. He is a normal vicar in the week with his own church and everything.
Originally Posted by polar
One cannot begin to fathom the immensity of the fuck I do not give.

-
08-01-2010, 16:06 #13Senior Member

- Join Date
- Jun 2005
- Posts
- 5,888
Re: Padres / Religion
If you are going to have a Padre, have a bike mad airborne one!
http://www.hogeuropegallery.com/hog-...etiton-winner/
-
12-01-2010, 01:02 #14
Re: Padres / Religion
I did a week climbing with him, what a legend
Originally Posted by The_Duke
-
12-01-2010, 01:14 #15
Re: Padres / Religion
One lad in my last unit put himself down as a pagan on joining. Roman Catholicism apparently covers paganism as well, at least according to his ID discs...
If you can't fix it with a hammer, it's an electrical problem.
-


LinkBack URL
About LinkBacks



Reply With Quote








Bookmarks